Background
Anopheles gambiae, An. arabiensis, An. funestus, and An. nili are the major malaria vectors in sub-Saharan Africa because they are anthropophilic and susceptible to Plasmodium falciparum
1
2
3
. These species belong to species complexes or groups, and members within these complexes/groups vary significantly in their vectorial capacity. Moreover, species can be further sub-divided into populations adapted to different environments. Some malaria control initiatives have failed because they targeted the wrong species or population
4
5
. Understanding and targeting the heterogeneity and complexity of all major vector species and populations is necessary for effective vector control and malaria eradication
6
.
Most studies of African malaria vectors have involved only An. gambiae, An. arabiensis, and An. funestus, while research on other important malaria vectors has critically lagged behind. For An. nili, this is partly because molecular and cytogenetic tools for characterizing population structure, ecological adaptation, and taxonomic status have been lacking. Anopheles nili is widely distributed and contributes substantially to malaria transmission in the African savannah and forested areas, where it breeds in lotic streams and rivers
7
8
. Sporozoite rates in this species can reach 3%, and the annual entomological inoculation rates can be over 100
9
. For example, An. nili is highly anthropophagous and responsible for 10.2% of malaria transmission in the densely populated area surrounding Yaounde, the capital of Cameroon
10
. Gaps in our knowledge of this vector represent a critical barrier to progress in the field of vector biology. Recent findings of circulation of P. falciparum and other Plasmodium species in great apes and other primates
11
12
13
raise concerns about pathogen transfer between humans and primates, and highlight the need to improve our knowledge of malaria vectors that inhabit forested areas in Central Africa.
Multi-allelic microsatellites are informative markers for inferring the population and taxonomic status of disease vectors and parasites
1
14
15
16
17
18
19
20
21
22
23
24
25
26
. Microsatellites are hyper-variable markers that tend to evolve neutrally. Eleven polymorphic microsatellite markers have been developed for An. nili
27
. Recently, the level of genetic variability and differentiation has been explored among nine populations of An. nili from Senegal, Ivory Coast, Burkina Faso, Nigeria, Cameroon, and The Democratic Republic of Congo (DRC)
1
. Genetic variability was determined by assessing polymorphisms at these 11 microsatellite markers, together with sequence variations in four genes within the ITS2, 28S rDNA subunit D3, and mitochondrial DNA. High F
ST
estimates based on microsatellites (F
ST
> 0.118, P < 0.001) were observed in all comparisons between Kenge in the DRC, and all other populations sampled from Senegal to Cameroon. Sequence variation in mtDNA genes matched these results; however, low polymorphism in rDNA genes prevented detection of any population substructure at this geographical scale. Both local adaptation and geographic isolation could cause this differentiation. Geographic isolation should affect all markers, even if they are unlinked (i.e. located in different chromosomes). However, chromosomal locations of the microsatellite markers and, therefore, the degree of their physical independence in the genome were unknown. Furthermore, because reduced recombination and increased selection within or near polymorphic inversions can result in estimates of gene flow that may differ significantly from those based on loci elsewhere in the genome
28
29
, it would also be important to know the location of microsatellite markers with respect to polymorphic inversions in An. nili when performing population genetic analyses.
Polymorphic chromosomal inversions are usually under selection and, thus, are useful markers for studying ecological adaptations of malaria mosquitoes
30
31
32
. The polymorphic inversions of chromosome 2 of An. gambiae have been associated with the arid Sahel Savanna
33
34
35
36
37
and with tolerance to desiccation and heat
38
39
. Moreover, frequencies of these inversions are higher indoors where the nocturnal saturation deficit is higher than outdoors
35
. Such ecological heterogeneity has important consequences for vector control. For example, indoor residual spraying of insecticides affected only indoor populations of An. gambiae in the Garki malaria control project in Nigeria
40
. Our previous cytogenetic analysis demonstrated that two polymorphic inversions, 2Rb and 2Rc, are present simultaneously in an An. nili mosquito. However, they display very different patterns of polymorphism. Frequencies of inverted and standard 2Rb variants were almost equal (with a deficiency of heterozygotes) in Burkina Faso, whereas only the standard arrangement was found in Cameroon. In contrast, inversion 2Rc occurred at higher frequency (without a deficiency of heterozygotes) in the dry savannah of Burkina Faso (83%) and at lower frequency in the humid rainforest of Cameroon (0.6%)
32
. Moreover, inversion 2Rc was found in the mountainous area (Magba), but not in the forested area (Mbebe) of Cameroon. These observations suggest the involvement of inversions in local adaptation (2Rb) or in an ecogeographic adaptive cline from dry to more humid environments (2Rc). Because An. nili is a forest-savannah transition species, polymorphic inversions could provide genetic plasticity that allows this species to expand its range from dry savannah to deforested areas of Central Africa, where most of the human population is present. The relationship between these two inversions has not been studied. For example, it would be useful to know if inversions 2Rb and 2Rc are in linkage disequilibrium (LD) in natural populations of An. nili.
In this study, we mapped nine microsatellite markers to polytene chromosomes of An. nili using fluorescent in situ hybridization (FISH). Plasmid clones of the An. nili microsatellites and/or ad hoc DNA fragments amplified from a low coverage assembly of the An. nili genome were used as probes. The microsatellites hybridized to unique locations on all chromosomes both inside and outside polymorphic inversions. We further demonstrated highly significant linkage disequilibrium between inversions 2Rb and 2Rc. This knowledge about polymorphic inversions and chromosomal locations of microsatellite loci helped us to better understand genetic variations and differentiation in natural populations of An. nili.
Results
Experimental approaches to microsatellite mapping
In the current study, we used three experimental approaches to map microsatellite markers to the polytene chromosomes from ovarian nurse cells of wild female An. nili specimens collected in Burkina Faso. In the first approach, microsatellites were amplified from genomic DNA using specific primers, which were previously developed
27
. All microsatellites were successfully amplified from the genomic DNA. However, because of the small size of the products (approximately 90-230 bp), a majority of the probes failed to hybridize to chromosomes. Only one microsatellite, 1F43, was mapped by this method. In the second approach, inserts containing microsatellites previously cloned in the pUC18 plasmid
27
were amplified using M13 forward and reverse primers. The insert sizes in this case ranged from 300 to 483 bp. Most of the microsatellites, except F41, B115, 2C157, and A154 were successfully labeled and hybridized to polytene chromosomes. Marker 1F43 was also mapped by the second approach to the same chromosomal region as in the first approach. In the third approach, we used a recently obtained genomic sequence assembly of An. nili to identify the microsatellite loci via BLASTN search and to design primers for PCR. These primers allowed the amplification of 506-559 bp-long PCR products containing the microsatellites that could not be hybridized previously. The An. nili genome was sequenced by Illumina 72 bp paired-end method using genomic DNA isolated from two individual larvae collected in Dinderesso, Burkina Faso. The assembly consisted of 51,048 contigs with a total length of 98,320,874 bp. The average contig length was 1,926 bp and the maximum contig length was 30,512 bp. Primers were designed for microsatellites B115, 2C157, and A154 (accession numbers: JF742787, JF742788, JF742789) based on sequences identified by BLASTN (Table 1). We successfully mapped microsatellites B115 and 2C157 to polytene chromosomes using this approach. However, microsatellite A154 failed to hybridize to chromosomes despite several attempts. The BLASTN search yielded multiple hits for microsatellite locus F41 in the An. nili genome because of widespread occurrence of the (CT)11TT(CT)8 repeats. The BLASTN search of the flanking regions did not yield any significant hits in the An. nili genome.
<p>Table 1</p>Primers designed for the microsatellite loci using the An. nili genome sequence.
Locus
Forward primer
Reverse primer
Size of PCR product
B115
CACGCTGGCTAAGAGGAAAC
CTGGTCTCTAGCACCCGAAG
559 bp
2C157
GAGAGCGGCTGTTCGTAATC
CGGACTGGCGAAATAAACAT
506 bp
A154
CACAGGGACGCCTAAAACAT
GACCCGCGTAACTAGGGAAT
537 bp
Locations of microsatellite markers on the chromosomal map of Anopheles nili
The An. nili chromosomal complement in ovarian nurse cells consists of five chromosomal arms: X, 2R, 2L, 3R and 3L. All nine microsatellites were mapped to unique locations on all autosomes and the X chromosome using FISH (Figure 1). We assigned these microsatellites to the precise positions on the recently developed polytene chromosome map of An. nili (Figure 2, Table 2). Two microsatellites hybridized to the X chromosome in subdivisions 2A and 3A; three microsatellites localized to the 2R arm in subdivisions 15C, 17AB and 18A; two microsatellites were mapped to the 3L arm in regions 38B and 44A; and arms 2L and 3R each hybridized with only one microsatellite marker in sections 20C and 31C, respectively. Only one microsatellite, 2C157, was mapped inside the previously described polymorphic inversion 2Rc. Microsatellite 1A27 localized to subdivision 15C located between inversions 2Rb and 2Rc. Microsatellite 1F43 was mapped to subdivision 18A located next to the proximal breakpoint of inversion 2Rc.
<p>Figure 1</p>FISH of microsatellites performed on the An. nili chromosomes
FISH of microsatellites performed on the An. nili chromosomes. Hybridizations of microsatellite markers 1G13 (A), 2Ateta and 1F43 (B), and B115 (C) with polytene chromosomes are shown. Chromosomes were counterstained with the fluorophore YOYO-1 and hybridized with fluorescently labeled probes Cy5 (blue) and Cy3 (red). The top panel shows fluorescent images of chromosomes after FISH. The bottom panel shows inverted grayscale chromosome images with color labels and distinct banding patterns.
![]()
<p>Figure 2</p>Physical chromosome map of the An. nili microsatellites
Physical chromosome map of the An. nili microsatellites. Chromosomal locations of nine microsatellite markers on polytene chromosomes are shown by arrows. Two polymorphic chromosomal inversions are indicated by brackets.
![]()
<p>Table 2</p>Location of the An. nili microsatellite markers on polytene chromosomes.
Locus
Accession number a (with length)
Location on the An. nili map
Location on the An. gambiae map
Best e-value for BLASTN
1.
A14
AJ536274 (467 bp)
X: 2A
X: 3D
3e-08
2.
1G13
AJ536271 (441 bp)
X: 3A
-
-
3.
1A27
AJ536268 (300 bp)
2R: 15C
-
-
4.
2C157
AJ536273 (404 bp) JF742788 (2,967 bp)
2R: 17AB
2R: 10A
7e-04
5.
1F43
AJ536270 (462 bp)
2R: 18A
-
-
6.
F41
AJ536277 (423 bp)
2R: unknown b
2R: 16D
2e-27
7.
2Ateta
AJ536272 (479 bp)
2L: 20C
3L: 45A
3e-17
8.
F56
AJ536278 (474 bp)
3R: 31C
-
-
9.
A154
JF742789 (1,522 bp)
3R: unknown b
3R: 30E
6e-43
10.
B115
AJ536276 (350 bp) JF742787 (10,057 bp)
3L: 38B
2L: 20D
3e-24
11.
1D80
AJ536269 (483 bp)
3L: 44A
-
-
a AJ refers to clone sequences; JF refers to assembled sequences.
b Arms determined based on the chromosome homology established earlier 19.
"-" no homologous sequence found in the An. gambiae genome using BLASTN.
Microsatellite mapping through comparative genomics with Anopheles gambiae
In this study, we identified sequences in the An. gambiae genome that are homologous to six microsatellite loci of An. nili (Table 2). The remaining five loci did not have significantly similar sequences in the An. gambiae genome. Markers A14, 2C157, 2Ateta, and B115, which we mapped in An. nili by FISH, were placed to specific regions of homologous chromosome arms in An. gambiae by BLASTN. The BLASTN results confirmed arm homologies between the two species that we determined in our previous study
32
. In addition, we mapped in silico microsatellites A154 and F41, which were not previously mapped by FISH. We used the Illumina-based genome sequence assembly of An. nili for A154 and the clone sequence for F41 to perform BLASTN against the An. gambiae genome. According to the established arm homology, we assigned microsatellites A154 and F41 to 3R and 2R chromosome arms of An. nili, respectively (Table 2).
Inversion polymorphism in Anopheles nili
To test if inversions 2Rb and 2Rc are in LD, we karyotyped 44 An. nili females collected in Dinderesso, Burkina Faso. Inversion frequencies were calculated jointly for these individuals and for 56 previously karyotyped females from the same village
32
. We found a highly significant LD between the two inversions (P = 0.00054), i.e., these inversions occur together much more often than expected. Frequencies of inverted and standard 2Rb variants were almost equal (0.51 and 0.49 for the standard and inverted arrangement, respectively). However, a highly significant departure from Hardy-Weinberg proportions due to a deficit in heterozygotes (e.g., positive F
IS
value) was observed at this locus (F
IS
= +0.603, P < 0.0001 single test level). Inversion 2Rc occurred at high frequency in the sample (0.825), with no significant deviation from Hardy-Weinberg equilibrium (HWE) (P = 0.49) (Table 3).
<p>Table 3</p>Chromosome inversion polymorphism in the An. nili population from Dinderesso, Burkina Faso.
2Rb
2Rc
Inversion frequency
0.490
0.825
F
IS
a
+ 0.603
+ 0.070
P (HW)b
<0.0001
0.49
aFIS was computed as in 59.
b Exact test for conformance to Hardy-Weinberg equilibrium, as implemented in the software in GENEPOP V4.0 58.
Discussion
Availability of readable polytene chromosomes in An. nili allowed us to develop a map of microsatellite markers and to study polymorphism of chromosomal inversions. Among the three experimental approaches used to map microsatellite markers to chromosomes, using cloned inserts and genome sequence assembly of An. nili to amplify and hybridize microsatellites was more successful than using microsatellite fragments amplified with primers for population genetics studies
1
27
(Figure 1). Larger DNA fragments were more suitable for effective labeling by the random primer method than smaller fragments obtained with primers for population genetic studies
27
. In addition to these experimental approaches, we conducted BLASTN searches of the An. nili genome fragments with microsatellites (both Illumina generated and cloned) against the An. gambiae genome to assign microsatellite loci to chromosome arms according to the synteny between An. nili and An. gambiae
32
(Table 2). Although, X, 2R, and 3R are homologous between the two species, the 2L arm of An. gambiae corresponds to the 3L arm of An. nili, and the 3L arm of An. gambiae corresponds to the 2L arm of An. nili, indicating the presence of a whole-arm translocation. Because of the high number of inversions fixed between the two species, the genome of An. gambiae cannot be used as a reference for precise positioning of microsatellites on the An. nili chromosomes. In our previous study, we calculated the minimum number of fixed inversions among An. nili, An. gambiae, and An. stephensi and concluded that An. nili is, at least, as diverged from An. gambiae as An. stephensi
32
. In addition to the fixed inversion differences, An. nili has a distinct pattern of polymorphic inversions. Therefore, the chromosomal positions of homologous loci with respect to polymorphic inversions will be different in the two species.
The developed microsatellite map (Figure 2) improved our understanding of the population genetic structure of An. nili. A recent study using 11 microsatellite markers demonstrated significant genetic differentiation of the An. nili population of Kenge in the DRC as compared to the An. nili populations in Central and West Africa
1
. Both local adaptation and geographic isolation could cause this differentiation. Extensive allele sharing between populations and homogeneity across loci suggested that enhanced genetic drift rather than selection was responsible for the observed pattern. Although it is unlikely that all loci would be within or close to the same inversion, chromosomal mapping of the markers was needed to determine the degree of their independence. Our study demonstrated that the microsatellite locations are not limited to one or a few specific regions in the genome but spanned the entire five-arm complement (Figure 2). Because most of these markers are physically unlinked, we conclude that enhanced genetic drift, rather than selection was responsible for reduced variability and increased differentiation of the Kenge, DRC population (see also Additional file 1). These data strongly suggest the role of the equatorial forest block as a barrier to gene flow between the south-African and north-African populations of An. nili.
<p>Additional file 1</p>
Re-analysing genetic differentiation between Anopheles nili populations from West and Central Africa. The file contains the genotypic data re-analyzed according to microsatellite loci cytological location. Locus-specific F
ST
values are shown in Table S1, together with F
ST
estimates across each chromosomal arm and overall. Locus-specific jackknifed mean F
ST
estimates (+/- standard deviation) between An. nili populations from West and Central Africa are shown in Figure S1.
Click here for file
Among the mapped microsatellite loci, 1A27 and A14 were found to be in particularly strong and significant departure from HWE due to a deficiency of heterozygotes in West Africa (Burkina Faso and Senegal) but not in Central Africa (Cameroon)
1
. We also detected a highly statistically significant departure from HWE due to a deficit in heterozygotes (F
IS
= +0.603, P < 0.0001 single test level, Table 3) at inversion 2Rb in the village of Dinderesso in Burkina Faso among 100 karyotyped females. It is possible that the 2Rb inversion plays a role in local adaptation and subdivides An. nili into populations with limited gene flow. This process or the presence of null alleles could cause heterozygote deficiency at microsatellite loci. In contrast, inversion 2Rc demonstrated no significant deviation from HWE (Table 3). However, we found a highly significant LD between the two inversions (P = 0.00054). Microsatellite 1A27 is located between 2Rb and 2Rc and it could be affected by the LD and reduced recombination in the vicinity of chromosomal breakpoints (Figure 2). Future studies should determine whether this LD is caused by physical linkage or selection. 2C157 is the only microsatellite located inside an inversion; and it does not demonstrate deficiency of heterozygotes. This locus is in the middle of inversion 2Rc where recombination could be close to normal. Moreover, significant departure from HWE due to a deficiency of heterozygotes was demonstrated for inversion 2Rb but not for 2Rc. Marker A14 is located on the X chromosome, which lacks polymorphic inversions, suggesting that genetic differentiation is not limited to the inversions (see Additional file 1 for locus-specific F
ST
estimates). Microsatellites in Hardy-Weinberg disequilibrium could also be associated with genes responsible for epidemiologically important ecological adaptations. Indeed, the microsatellite motif of A14 is located 259 bp upstream from the start codon of an open reading frame in the An. nili genome, and the sequence homologous to the A14 clone is found in the 5'UTR and the first exon of the An. gambiae gene AGAP000275. According to gene ontology annotation, the protein encoded by this gene has oxidoreductase activity. The transcript of AGAP000275 has demonstrated significant differential expression in a variety of mosquito tissues and life stages. Significant differences have been shown between: different stages of embryonic development, between embryonic serosa and embryo
41
, between blood-fed and non-blood-fed females, between fat body and ovaries, between males and females, between adults and larva
42
, between hemolymph and carcass
43
, between West and East African strains of S form gravid females
44
, between larval anterior midgut and hindgut
45
, between larval salivary gland and whole organism
46
. Significant 1.2-fold increase in the transcription level of AGAP000275 has also been found between females 6 hours and 24 hours after mating
47
. Altogether, these data suggest strong selection acting on AGAP000275 in An. gambiae that might translate into non-neutral polymorphism distribution at locus A14 in An. nili. Sequences homologous to other An. nili microsatellite loci with significant BLASTN hits in the An. gambiae genome were found outside genes, except microsatellite B115, which was located within the second intron of gene AGAP004824.
Our recent mapping of 12 microsatellites to An. stephensi chromosomes has demonstrated that the chromosomal position of microsatellites may affect estimates of population genetic parameters
48
. In a similar study of An. funestus, 16 microsatellites were physically mapped to polytene chromosomes, and the location of microsatellites based on the inversions were determined
49
. Interestingly, microsatellites located between inversions 3Ra and 3Rb in An. funestus were found in LD with these inversions in Burkina Faso
50
but not in Cameroon
30
, reflecting different evolutionary outcomes in different eco-geographic regions. Altogether, these studies point to the importance of physical mapping of molecular markers exposed to contrasted evolutionary dynamics for unravelling the demographic and evolutionary history of malaria vectors. This paper provides the necessary toolbox for such endeavour to be pursued in An. nili.
Conclusions
Our study demonstrates that the chromosomal position of microsatellites is informative for interpretation of population genetics data and highlights the importance of developing physical maps for nonmodel organisms. Next-generation sequencing can be used for designing microsatellite primers to obtain longer microsatellite-containing probes and improve FISH mapping. An Illumina-based genome sequence assembly can also be used for identifying homologous loci in the reference genomes and assigning microsatellite markers to chromosomal arms in a species of interest based on synteny. The integrated chromosomal map of microsatellites and inversions will allow for more complete characterization of An. nili in future population genetics studies. It will be possible to test for a LD among and between inversions and microsatellites, genetic differentiation at microsatellite loci located inside and outside inversions, and genetic differentiation according to the distance from inversion breakpoints. In addition, the new genetic map could be used for designing quantitative trait loci mapping studies for this species.
Methods
Wild mosquito collection, preservation, and species identification
Anopheles nili adult females were collected by pyrethrum spraying and bednet traps in the village of Dinderesso (11°14'N; 4°23'W) in Burkina Faso. Anopheles nili larvae were collected in a river in Dinderesso, Burkina Faso. Specimens were identified in the field as members of the An. nili group by using morphological identification keys
51
52
53
and were further characterized by molecular assays as An. nili s.s.
54
. Females were dissected under a microscope, and their ovaries at the appropriate stage were preserved in Carnoy's fixative solution (3 parts of ethanol: 1 part of glacial acetic acid by volume). Ovaries were kept at room temperature overnight before being stored at -20°C. Larvae were preserved in Carnoy's fixative solution and stored at -20°C.
Genome sequencing and BLASTN
The genome assembly for An. nili was obtained by sequencing of genomic DNA isolated from two larvae collected in Dinderesso, Burkina Faso. Genomic DNA was isolated using the Qiagen DNeasy Blood and Tissue Kit (Qiagen Science, Germantown, MD, USA). The library preparation and sequencing was performed on the Illumina Genome Analyzer IIx, using 72 bp paired-end processing at Ambry Genetics Corp. (Aliso Viejo, CA, USA). Samples were prepared using the Illumina protocol outlined in "Preparing Samples for Sequencing Genomic DNA" (Part # 11251892 Rev. A 2007). Briefly, DNA fragment ends were repaired and phosphorylated using Klenow, T4 DNA Polymerase and T4 Polynucleotide Kinase. Next, an 'A' base was added to the 3' end of the blunted fragments, followed by ligation of Illumina paired-end adaptor via T-A mediated ligation. The ligated products were size selected by gel purification and then PCR amplified using Illumina Paired-End primers. The library size and concentration were determined using an Agilent Bioanalyzer. The library was seeded onto the flowcell at 8 pM, yielding approximately 275 K clusters per tile, and it was sequenced using 73 cycles of chemistry and imaging (73 cycles) for read 1 and read 2. Initial data processing, including extraction of cluster intensities and base calling, was done using RTA 1.6.47 (SCS version 2.6.26). Sequence quality filtering scripts were executed in the Illumina CASAVA software (ver 1.6.0, Illumina, Hayward, CA). Quality metric data included the approximate proportion of sequences with 1, 2, 3 or 4 errors, IVC plots, and visualizations of cluster intensity over the duration of the sequencing run. The BLASTN algorithm was used to identify homologous sequences in the An. gambiae genome, which is available at VectorBase
55
. The BLASTN algorithm was also used to find larger genomic fragments with microsatellite loci in the An. nili genome using a server and the Geneious 5.1.5 software http://www.geneious.com, a bioinformatics desktop software package produced by Biomatters Ltd http://www.biomatters.com.
Probe preparation
Three approaches were utilized for the microsatellite probe preparation. First, microsatellites were directly amplified from the An. nili genomic DNA using previously designed primers
27
. Approximately 90-230 bp-long fragments were amplified. Second, plasmid clones with microsatellites were used as templates for insert amplification. In this case, 300-483 bp-long fragments were amplified from the pUC18 plasmid DNA using standard M13 forward and reverse primers (Fermentas, Inc., Glen Burnie, MD, USA). Third, primers were designed for three microsatellites using the Primer3 program
56
based on sequences identified by BLASTN in the genome assembly of An. nili (accession numbers: JF742787, JF742788, JF742789). The size of these fragments was about 506-559 bp. PCR conditions were as follows: 94°C for 5 min; 45 cycles of 94°C for 45 s, 50°C for 45 s and 72°C for 30 s; and 72°C for 5 min. DNA was purified using the GE healthcare illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare UK Ltd, Buckinghamshire, UK). Probes were labeled using Cy3-AP3-dUTP or Cy5-AP3-dUTP (GE Healthcare UK Ltd., Buckinghmashire, UK) fluorophores by a Random Primer DNA Labelling System (Invitrogen Corporation, Carlsbad, CA, USA).
Chromosome preparation and FISH
To obtain chromosomal slides, follicles of ovaries were separated in 50% propionic acid. Then a cover slip was used to squash the follicles. The quality of slides and the banding pattern of polytene chromosomes were analyzed using an Olympus CX-41 phase contrast microscope (Olympus America Inc., Melville, NY, USA). Slides then were dipped into liquid nitrogen, cover slips were removed, and slides were dehydrated in 50%, 70%, 90% and 100% ethanol. Slides were air dried and used for further experiments. Labelled probes were hybridized at 42°C to An. nili polytene chromosome slides overnight. Then, slides were washed in 0.2 X SSC (Saline Sodium citrate, 0.03 M sodium chloride and 0.03 M sodium citrate) at 42°C and room temperature. Chromosomes were stained using YOYO-1 (Invitrogen Corporation, Carlsbad, CA, USA), and slides were mounted in 1,4-diazabicyclo[2.2.2]octane (DABCO) antifade solution. A Zeiss LSM 510 Laser Scanning Microscope (Carl Zeiss MicroImaging, Inc., Thornwood, NY, USA) was used to detect fluorescent signals. Microscopic images were taken from the signal, and the locations of signals were determined using a standard cytogenetic photo map of An. nili
32
.
Image processing
Confocal images were processed using ImageJ and Adobe Photoshop software as described elsewhere
57
. Briefly, color channels were split from the initial RGB image into separate images. Each channel image was converted into the monochrome image by using a 'Channel mixer' and then inverted. The inverted monochrome image was adjusted by using a 'Curves' tool until the background is removed and each chromosome of the spread becomes fuzzy-edged. The reduction of noise was achieved by blurring of each pixel with the Gaussian blur filter tool. The quality of the image was improved by additional application of the 'Curves' and/or subtraction of the 'Relative white'. Finally, green channel image with chromosomes was merged with monochrome image FISH signals. Processing yielded contrasted, inverted, grayscale images with color labels, which are more suitable for mapping.
Population genetics analyses
Homozygous and heterozygous inversions were scored using the chromosomal map published earlier
32
. Alternative chromosomal arrangements were considered as different alleles of the same locus, and conformance to Hardy-Weinberg equilibrium was tested with Fisher's exact tests available in GENEPOP V4.0
58
. A F
IS
value was computed as in
59
. LD between the inversions 2Rb and 2Rc was assessed using the log likelihood ratio statistic (G-test) available in GENEPOP V4.0
58
.
List of abbreviations
BLASTN: Basic Local Alignment Search Tool for Nucleotide sequences; DABCO: 1,4-diazabicyclo [2.2.2] octane; FISH: fluorescent in situ hybridization; HWE: Hardy-Weinberg equilibrium; LD: linkage disequilibrium.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
IVS designed research; AP, IVS, and MVS performed karyotyping and physical mapping; CAN and CN conducted field work and mosquito identification; FS, MVS, and IVS analyzed data; MW prepared plasmid DNA; AP and IVS prepared genomic DNA for sequencing; IVS performed BLASTN searches using VectorBase and a Geneious software; AP and IVS wrote the paper, which was critically revised by CAN, FS, and MVS. All authors read and approved the final manuscript.