Table 1

Summary of specific PCR and real-time PCR methods used in this study on cats from Albania
Target Primers 5′-3′ Cycle conditions Reference
Conventional PCR methods
Bartonella spp. 16S-23S ITS (154–260 bp) B. henselae: 172 bp Barhen1_for: YCTTCGTTTCTCTTTCTTCA 44 cycles: 30 Sec 94°C, 30 Sec 60°C, 30 Sec 72°C [12]
Barhen2_rev: AACCAACTGAGCTACAAGCC
Mycoplasma haemofelis/Candidatus M. haemominutum 16S rRNA gene (274 bp/202 bp respectively) OHOK1_for: ATGCCCCTCTGTGGGGGATAGCCG 35 cycles: 45 Sec 94°C, 45 Sec 58°C, 45 Sec 72°C [13]
CaB2_for: CTGGGAAACTAGAGCTTCGCGAGC
OOCBr1_rev: ATGGTATTGCTCCATCAGACTTTCG
Real-time PCR methods
Leishmania infantum Kinetoplast ~700 bp Lsh-kF: CTTTTCTGGTCCTCCGGGTAGG All Real-time PCR methods: 2 min 50°C, 10 min 95°C, 40 cycles: 15 Sec 95°C, 1 min 60°C [14]
Lsh-kR: CCACCCGGCCCTATTTTACACCAA
Lsh-kp: FAM-TTTTCGCAGAACGCCCCTACCCGC-BHQ1
Anaplasma phagocytophilum: Msp2 gene (77 bp) ApMSP2f: ATGGAAGGTAGTGTTGGTTATGGTATT [15]
ApMSP2r: TTGGTCTTGAAGCGCTCGTA
ApMSP2p-FAM: TGGTGCCAGGGTTGAGCTTGAGATTG
Candidatus M. turicensis 16S rRNA gene (85 bp) HS Real2_for: GAAGGCCAGACAGGTCGTAAAG [16]
HS Real2_rev: CTGGCACATAGTTWGCTGTCACTTA
HS RealT: FAM-AAATTTGATGGTACCCTCTGA-MGB

Silaghi et al.

Silaghi et al. Parasites & Vectors 2014 7:62   doi:10.1186/1756-3305-7-62

Open Data