Abstract
Background
It is known that Anaplasma (A.) platys, the causative agent of infectious canine cyclic thrombocytopenia, is endemic in countries of the Mediterranean basin. However, few reports are available from the Balkans. This case report describes a dog, which was imported from Croatia to Germany in May 2010. One month later the dog was presented to a local veterinarian in Germany due to intermittent/recurrent diarrhoea. Diagnostic tests were performed to identify infections caused by Anaplasma spp., Ehrlichia spp., Hepatozoon canis, Babesia spp., Leishmania spp., Borrelia burgdorferi and/or Dirofilaria immitis.
Findings
Haematological examination of a blood smear revealed basophilic inclusions in thrombocytes, which were confirmed as A. platys with a species-specific real-time PCR. Additionally, an infection with Babesia (B.) vogeli was also detected (PCR and serology). No specific antibodies against Anaplasma antigen were detectable. Although the dog showed no specific clinical signs, thrombocytopenia, anaemia and elevated C-reactive protein (CRP) were observed. Sequencing of a 1,348-bp partial ribosomal RNA gene revealed highest homology to A. platys sequences from Thailand, Japan and France.
Conclusions
A. platys was detected for first time in a dog imported from Croatia. As the dog was also co-infected by B. vogeli, unique serological and haematological findings were recorded. Thrombocytopenia, anaemia and elevated values of C-reactive protein were the laboratory test abnormalities observed in this case. A. platys infections should be considered in dogs coming from Croatia and adjacent regions.
Keywords:
Anaplasma platys; Babesia vogeli; CRP; Infectious canine cyclic thrombocytopenia; CroatiaBackground
Anaplasma platys (formerly Ehrlichia platys) was first identified and described in 1978 in Florida (USA) as a Rickettsia-like, platelet-specific organism in dogs with infectious canine cyclic thrombocytopenia (ICCT) [1]. Based on morphology and serological cross-reactions with Ehrichia canis, the microorganism was first proposed as E. platys [2]. Sequencing and phylogenic analysis of the 16S rRNA gene and GroESL operon showed that the pathogen was related to A. phagocytophilum and A. marginale, which led to reclassification and designation as A. platys [3,4].
In dogs A. platys organisms infect peripheral blood platelets and form basophilic inclusions in the cells, so-called morulae, which contain one or more subunits [1,5]. Both, the appearance of the pathogen in the platelets and the following thrombocytopenia are cyclic [1]. The initial thrombocytopenias may develop primarily as a consequence of direct injury to platelets by replicating organisms. However, immune-mediated mechanisms of thrombocytopenia become more important in subsequent thrombocytopenic episodes [1]. The fraction of infected platelets decreases dramatically in successive parasitaemias, but the associated thrombocytopenic episodes remain severe [6]. In general, the infection is accompanied by unspecific and mild clinical manifestation including anorexia, depression, generalized lymph node enlargement, pale mucous membranes and elevated rectal temperatures [1,7-9]. Nevertheless, a severe course of A. platys infection with ecchymotic haemorrhagia was reported to be caused by a Greek strain [10]. The pathogen is assumed to be transmitted by Rhipicephalus sanguines, as in several studies A. platys-DNA was detected in this tick species and co-infections in dogs with E. canis and B. vogeli, two pathogens that share the same vector, reinforce this speculation [11-13]. The vector competence of R. sanguineus, however, could not be proven so far [14]. Currently, A. platys has been described in both American continents (USA [2], Venezuela [15], Brazil [16]), Asia (China [17], Thailand [12], Taiwan [18], Japan [19]), Australia [20] and Africa [21]. In Europe the occurrence of A. platys has been shown in Mediterranean countries: Italy [22], France [23], Spain [8], Portugal [24], Turkey [25] and Greece [10]. Here the first case of a presumed autochthonous A. platys infection is described in a dog from Croatia.
Case report
A one-year-old male dog was imported from Croatia to Germany in May 2010 and, according to the owner declaration, has never been outside Croatia before. The dog was presented to a local veterinarian in Germany one month after the import due to intermittent/recurrent diarrhoea. Diagnostic tests for infections uncommon for the German area were requested (CBC with blood smear review, complete serum chemistry analysis as well as a "travel disease profile"). No abnormalities were found during the clinical assessment.
Blood analysis indicated anaemia with erythrocytes at 4.20 T/L (reference range 6-9 T/L), haemoglobin of 9.4 g/dL (reference range 15-19 g/dL) and haematocrit of 32% (reference range 38-55%). The anaemia was classified as normocytic at the upper limit to macrocytic (MCV of 75 fL; reference range 60-75 fL) as well as hypochromic due to a mean corpuscular hemoglobin concentration (MCHC) lower than the reference range (30 g/dL; reference range 31-34 g/dL). Thrombocytopenia was registered as well (62 × 109/L; reference range 150-500 × 109/L). The differential and absolute white blood cell (WCB) counts were within the usual range (Table 1). Biochemistry parameters were within the reference range apart from a total protein at the lower limit of the reference range (53 g/L; 53-77 g/L), decreased albumin values of 2.70 g/dL (3.2-4.7 g/dL) as well as increased urea nitrogen of 34.7 mg/dL (10-25 mg/dL) and phosphorus at 2.0 mmol/L (0.7-1.6 mmol/L). A subsequent immunological examination revealed an elevated C-reactive protein (CRP, 38.2 mg/L; reference range 0-9.7 mg/L). In addition, the examination of a blood smear revealed basophilic inclusions in thrombocytes resembling A. platys (Figure 1). The following A. phagocytophilum and A. platys-specific PCRs confirmed the A. platys infection. The A. platys-positive PCR result (cycle threshold (Ct) value 19.1) was accompanied by a B. vogeli-positive PCR (Ct value 35.8). PCR testing for other Babesia (including B. canis, B. rossi, B. gibsoni, B. conradae), Hepatozoon canis, Ehrlichia spp. (including E. canis, E. chaffeensis, E. ewingii) and Leishmania spp. were negative. Serological assays as the SNAP 4Dx test (antibodies to A. phagocytophilum, E. canis, Borrelia burgdorferi and antigen of Dirofilaria immitis), microplate ELISA for antibodies against Leishmania infantum and IFA on A. phagocytophilum, E. canis, and Leishmania-antigen produced negative results. In contrast, a B. canis-specific ELISA was positive (a low level of antibodies at 20.2 test units was detected).
Table 1. Patient's haematological and serum biochemical parameters at the time of clinical examination
Figure 1. A. platys inclusion in blood platelets (arrows); Giemsa-stained blood smear of the dog presented
in this report.
Based on abnormal clinicopathological findings in conjunction with the positive PCR results, specific therapy with doxycycline (10 mg/kg, orally, SID) was initiated for four weeks. After three weeks of Doxycycline therapy, a single injection of imidocarb dipropionate (6 mg/kg) was administered subcutaneously. In the following hours after the application the general health condition of the dog worsened, described as an anaphylactic reaction by the in-clinic veterinarian. Despite the immediate use of infusions and the administration of parenteral atropine, the dog died the next day.
Methods
Blood analysis
Blood was collected on the day of the presentation in the clinic. CBC with blood smear review was performed on the sample paying particular attention to blood parasites and hemotropic bacteria, as was complete serum chemistry (IDEXX Vet Med Lab). CRP concentrations were measured by means of a validated CRP immunoturbidimetric assay.
DNA extraction and diagnostic PCRs
Total DNA was extracted from whole blood by using QIAamp DNA Blood Mini kit (QIAGEN, Germany) according to the manufacturer's instructions. Real-time PCR at IDEXX Vet Med Lab was performed using the LightCycler 480 (Roche) with proprietary forward and reverse primers and hydrolysis probes. Target genes for pathogen detection using real-time PCR were as follows: A. platys (groEL), A. phagocytophilum (msp2), B. vogeli, B. canis, B. rossi, B. gibsoni (hsp 70), B. conradae (ITS2), H. canis (18S rRNA), Leishmania spp. (GP63), E. canis, E. chaffeensis, E. ewingii (dsb).
Serological examinations
Serological examinations for antibody detection were performed using an A. phagocytophilum IFA (MegaScreen FLUOANAPLASMA ph., cut-off = 1:50, MegaCor, Hoerbranz, Austria), a microplate L. infantum ELISA (Leishmania-ELISA Dog, Afosa GmbH Dahlewitz, Germany; reference range: negative < 7, borderline 7-12 and positive > 12), an E. canis IFA (MegaScreen FLUOEHRLICHIA c., cut-off = 1:40, MegaCor, Hoerbranz, Austria), and a microplate B. canis ELISA (Babesia-ELISA Dog, Afosa GmbH Dahlewitz, Germany; reference range: negative < 14, borderline 14-19 and positive > 19). In regard to B. vogeli, positive reactions were documented earlier utilizing a B. canis IFA test [26]. Furthermore, a rapid enzyme immunoassay assay test system (IDEXX SNAP® 4Dx®) was used as described elsewhere [27] following the manufacturer's directions. The IDEXX SNAP® 4Dx® detects antibodies against A. phagocytophilum (p44), Borrelia burgdorferi sensu lato (C6), E. canis (p30, p30-1) as well as antigen of Dirofilaria immitis.
Sequencing of 16S ribosomal RNA gene and sequence analysis
A 1,400-bp fragment of the 16S ribosomal RNA gene was amplified from total blood DNA by using forward (AGAGTTTGATCCTGGCTCAG) and reverse (CGGCTACCTTGTTACGACTT) Anaplasmataceae-specific primers, which were modified according to a study published elsewhere [28]. The reactions were prepared in total volumes of 50 μl with 15 pmol each primer, 0.2 mM each dNTP and 2 U Pwo DNA-polymerase in a 1× polymerase specific buffer complemented with MgSO4. After an initial denaturation step at 94°C the reactions cycled 30 times at 94°C for 30 sec, 58°C for 45 sec, 68°C for 90 sec and finally incubated at 68°C for 5 min in a Mastercycler pro (Eppendorf, Hamburg, Germany). The PCR products were purified with a peqGOLD Gel extraction Kit (PEQLAB, Erlangen, Germany) and submitted for sequencing to Eurofins MWG Operon (Ebersberg, Germany). The PCR product was sequenced three times in both directions. A 1,348-bp partial ribosomal RNA sequence was deposited to GenBank™ under accession number JQ396431.
Results and discussion
With the exception of intermittent/recurrent diarrhoea the dog had no clinical signs, but anaemia and thrombocytopenia were evident in the haemogram (Table 1). Both are common, major abnormal clinicopathological findings observed in A. platys and B. vogeli-co-infected dogs [13] and are in concordance with the positive PCR results for A. platys and B. vogeli found in the dog. Infections with A. platys are difficult to detect, as in most cases the clinical manifestations are not clearly evident. B. vogeli infections usually cause subclinical to mild or moderate changes in adult dogs, however, concomitant conditions or additional pathogens present at the same time can exacerbate the course of infection [29].
Thrombocytopenia due to a monoinfection with A. platys has a cyclic character and is considered the result of the destruction of blood platelets by the proliferating pathogen during initial phase of infection, which probably triggers immunologic mechanisms in the subsequent course of the infection [6]. In B. vogeli-infected dogs, regenerative haemolytic anaemia is a well-known feature, but not all naturally infected dogs become anaemic. Furthermore, B. vogeli infections do not show a homogenous clinicopathological pattern [29,30]. Indeed, thrombocytopenia was reported to also be a haematological abnormality of B. vogeli infections, even though the decrease of platelets in blood is a consistent haematological abnormality in B. canis infections [30,31]. The thrombocytopenia can be enhanced by mixed A. platys and B. vogeli infections leading to significantly lower numbers of platelets compared to single pathogen infection [20]. Both, thrombocytopenia (2.5 fold below lower limit of normal range) and anaemia (low value of RBC count, haemoglobin and haematocrit), were found in the presented case (Table 1). Based on data generated with additional PCR and serology tests there was no evidence of co-infections with other pathogens such as A. phagocytophilum, H. canis, Ehrlichia spp. and Leishmania spp., which may occur also in Croatia and could take further influence on haematological parameters [32-34]. On the other hand, at the moment there are no available reports confirming the occurrence of E. canis in Croatia.
As representatives for acute phase proteins C-reactive protein (CRP, belonging to positive acute phase proteins) and albumin (negative acute phase protein) were evaluated, which in fact showed abnormal values. While CRP was elevated to up to 38.2 mg/L (reference range 0-9.7 mg/L), the serum albumin was decreased to 2.7 g/dL (reference range 3.2-4.7 g/dL) indicating systemic involvement likely due to a co-infection of A. platys and B. vogeli. Acute phase response as a part of the innate host defence system is linked to early innate responses for any pathological processes or diseases as reviewed elsewhere [35,36]. In dogs, CRP is known to show the highest response among acute phase proteins and has been used as an early unspecific marker [35]. An increase of CRP in dogs has been reported for many diseases caused for example by B. canis [31], E. canis [37], L. infantum [38] and A. phagocytophilum [39]. Thus far, no comprehensive investigations of acute phase response in tick-borne concurrent infections such as A. platys and B. vogeli exist.
The serological tests (IFA and SNAP 4Dx) based on A. phagocytophilum antigen failed to detect antibodies in the present case, but an ELISA based on B. canis antigen produced a positive result. However, the antibody level was low. It is known, that IFA tests with B. canis as a substrate cross-react with antibodies against B. vogeli and B. rossi, but homologous species antigens will cause stronger reactions [40]. Furthermore, that exact time point of seroconversion is not known for a natural B. vogeli infection and follow-up serological examinations after initial PCR-positive results, as shown previously [26], was not possible in the present case. The attempt to detect antibodies against A. platys was based on cross-reaction with A. phagocytophilum antigen. It has previously been shown, that the serum samples from naturally infected A. platys dogs from USA and China react positively with A. phagocytophilum antigen on the SNAP 4Dx [41,42]. Furthermore serum samples from A. platys infected animals in Portugal react well by means of IFA with A. phagocytophilum antigen [43]. Therefore, strain differences do not appear be a reason for the negative serological tests in the present study. According to the literature, seroconversion as a consequence of an A. platys mono-infection occurs between 13 to 19 days post infection as shown with strains collected in US and Greece [2,10]. As the dog was imported approx. 30 days before sampling to Germany and it is unlikely that the infection was acquired in Germany, an unusually long seronegative period can be inferred. It can be speculated that the tested blood samples were collected during the acute phase of infection probably before seroconversion occurred. This would be in concordance with negative IFA results as well as with high C-reactive protein and severe thrombocytopenia as described in A. phagocytophilum-infections previously [39]. The other possible reason for the seronegativity could be the dual infection. In case of a simultaneous infection with A. platys and E. canis it was documented, that A. platys-specific antibodies were detectable for the first time on average 27 days (range 14-35 days) post infection [42]. Consequently, the concurrent infections of A. platys and B. vogeli might have induced a delay in the humoral immunological response in this patient.
Intermittent diarrhoea was a reason for the presentation of the dog. The possible cause for the diarrhoea remains unknown, as no faecal sample was examined. But, it seems unlikely that intermittent diarrhoea alone could have led to hypoalbuminemia in the dog due to substantial gastrointestinal loss of fluids.
The dog died shortly after imidocarb dipropionate administration. However, the cause of death stays speculative, because no post-mortem examination was performed. An anaphylactoid reaction was observed in this case. Such reactions were described after imidocarb dipropionate administration in rare cases [44], while side effects of the drug (hypotension, hypersalivation, nasal discharge, lacrimation, diarrhoea, vomiting) can be reduced by atropine pretreatment. Furthermore, occasional renal tubular necrosis and hepatotoxicity after treatment have been described also [45,46]. In this case the elevated urea nitrogen of 34.7 mg/dL (reference range 10-25 mg/dL) and creatinine within the reference range (0.9; reference range < 1.4 mg/dl) are indicative for azotaemia but not for a strong renal involvement, which could exacerbate the side effects of imidocarb dipropionate therapy. In a group of seven dogs with B. canis infection, which had been preselected due to renal involvement and treated with imidocarb dipropionate, four dogs died spontaneously and the kidneys of all animals of the group showed degenerative changes of mainly the proximal convoluted tubules as well as necrosis of the whole tubule in some cases [47]. The authors reported that the histological alterations seen in the dogs were similar in dogs treated with imidocarb dipropionate and in the untreated animal. Hence, the pathological changes observed in the kidneys cannot be explained exclusively by the potential nephrotoxicity of imidocarb dipropionate [47]. In the case presented here it remains open, whether the dog died because of the side effects or as a result of the combined impact of the observed B. vogeli and A. platys infections. Nevertheless, it is recommended to treat simultaneously even mildly azotaemic dogs with proper intravenous fluid therapy when imidocarb dipropionate is applied and lower the dose of the drug (e.g. 3 mg/kg) in patients suspected to have renal involvement, in order to decrease the risk of renal insufficiency [47].
Sequencing of the 16S rRNA gene produced a 1,348-bp sequence, which was identical to other A. platys 16S rRNA sequences generated in Thailand (EF139459), Japan (AY077619) and France (AF303467). The analysis of 16S rRNA sequences confirms the previous results, in which little genetic diversity was observed in 16S rRNA sequences of A. platys strains from different geographic locations [8,22,48].
The mixed A. platys and B. vogeli infection is well known from previous reports and represents a large fraction of co-infections among tick borne pathogens in dogs [20,26,49]. The examination of free-roaming dogs associated with remote Aboriginal communities in Australia showed 11% of dogs co-infected with both A. platys and B. vogeli [20]. The occurrence of B. vogeli in Croatia and other southern European countries is well documented [32]. The natural occurrence of A. platys in moderate climate zones and simultaneous coinfections with Babesia spp. allow the assumption that Rhipicephalus sp. e.g. Rhipicephalus sanguineus ticks may serve as the natural vector. On the other hand, this tick species has a wide genetic diversity [50] making it difficult to find the definitive vector for A. platys. The detection of A. platys in non-engorged questing adult Rhipicephalus turanicus tick in Israel [51] raises the question, whether other Rhipicephalus species actually serve as vectors for this agent.
To our knowledge this is the first report of A. platys infection in a dog imported from Croatia. Based on the owner's declaration, the dog has never travelled abroad before importation to Germany and the dog was presumably infected in Croatia. The infection in Germany is unlikely due to the following reasons: the vectors Rhipicephalus spp. ticks are commonly not present in Germany, even though ticks imported from abroad with travelled dogs can survive in homes with moderate temperatures [52]. The dog owners in Germany, however, did not report any tick infestation and so far there are no reports of autochthonous occurrences of B. vogeli and A. platys from the region where the dog spent its final days.
Conclusions
A. platys infection was detected for the first time in a dog imported from Croatia. A co-infection with B. vogeli probably induced the untypical serological results. The major clinical manifestations were thrombocytopenia, anaemia and elevated values of C-reactive protein. A. platys infection should be considered in dogs living in or returning after travel from this area and showing abnormal clinicopathologic findings described in this report.
Abbreviations
ICCT: Infectious canine cyclic thrombocytopenia; CRP: C-reactive protein; IFA: Immunofluorescence antibody assay; WCB: White blood cell; ELISA: Enzyme linked immunosorbent assay; Ct: Cycle threshold; CBC: Complete Blood Count; SID: Once daily.
Competing interests
The authors have no competing interests.
Authors' contributions
VD wrote the manuscript and performed sequencing and analysis of 16S rRNA. NP performed serological and clinicopathologic examinations, case consultation and correction of manuscript. H-JB performed diagnostic PCRs and correction of manuscript. AM performed anamnesis, clinical examination and treatment. RKS supervised and revised the manuscript. All authors read and approved the final version of the manuscript.
References
-
Harvey JW, Simpson CF, Gaskin JM: Cyclic thrombocytopenia induced by a Rickettsi-like agent in dogs.
J Infect Dis 1978, 137:182-188. PubMed Abstract | Publisher Full Text
-
French TW, Harvey JW: Serologic diagnosis of infectious cyclic thrombocytopenia in dogs using an indirect fluorescent antibody test.
Am J Vet Res 1983, 44:2407-2411. PubMed Abstract
-
Yu XJ, Zhang XF, McBride JW, Zhang Y, Walker DH: Phylogenetic relationships of Anaplasma marginaland 'Ehrlichia platy' to other Ehrlichispecies determined by GroEL amino acid sequences.
Int J Syst Evol Microbiol 2001, 51:1143-1146. PubMed Abstract | Publisher Full Text
-
Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR: Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichiwith Anaplasm, Cowdriwith Ehrlichiand Ehrlichiwith Neorickettsi, descriptions of six new species combinations and designation of Ehrlichia equ and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophil.
Int J Syst Evol Microbiol 2001, 51:2145-2165. PubMed Abstract | Publisher Full Text
-
Arraga-Alvarado C, Palmar M, Parra O, Salas P: Ehrlichia platy(Anaplasma platy) in dogs from Maracaibo, Venezuela: an ultrastructural study of experimental and natural infections.
Vet Pathol 2003, 40:149-156. PubMed Abstract | Publisher Full Text
-
French TW, Harvey JW: Canine Infectious Cyclic Thrombocytopenia (Ehrlichia platyInfection in Dogs). In Rickettsial and chlamydial diseases of domestic animals. Edited by Woldehiwet Z, Ristic M. New York: Pergamon Press; 1993:195-208.
-
Harrus S, Aroch I, Lavy E, Bark H: Clinical manifestations of infectious canine cyclic thrombocytopenia.
Vet Rec 1997, 141:247-250. PubMed Abstract | Publisher Full Text
-
Aguirre E, Tesouro MA, Ruiz L, Amusategui I, Sainz A: Genetic characterization of Anaplasm(Ehrlichi)platy in dogs in Spain.
J Vet Med B Infect Dis Vet Public Health 2006, 53:197-200. PubMed Abstract | Publisher Full Text
-
Baker DC, Simpson M, Gaunt SD, Corstvet RE: Acute Ehrlichia platyinfection in the dog.
Vet Pathol 1987, 24:449-453. PubMed Abstract | Publisher Full Text
-
Kontos VI, Papadopoulos O, French TW: Natural and experimental canine infections with a Greek strain of Ehrlichia platy.
Vet Clin Pathol 1991, 20:101-105. PubMed Abstract | Publisher Full Text
-
Inokuma H, Raoult D, Brouqui P: Detection of Ehrlichia platyDNA in brown dog ticks (Rhipicephalus sanguineu) in Okinawa Island, Japan.
J Clin Microbiol 2000, 38:4219-4221. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Suksawat J, Pitulle C, Arraga-Alvarado C, Madrigal K, Hancock SI, Breitschwerdt EB: Coinfection with three Ehrlichispecies in dogs from Thailand and Venezuela with emphasis on consideration of 16S ribosomal DNA secondary structure.
J Clin Microbiol 2001, 39:90-93. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
de Caprariis D, Dantas-Torres F, Capelli G, Mencke N, Stanneck D, Breitschwerdt EB, Otranto D: Evolution of clinical, haematological and biochemical findings in young dogs naturally infected by vector-borne pathogens.
Vet Microbiol 2011, 149:206-212. PubMed Abstract | Publisher Full Text
-
Simpson RM, Gaunt SD, Hair JA, Kocan KM, Henk WG, Casey HW: Evaluation of Rhipicephalus sanguineuas a potential biologic vector of Ehrlichia platy.
Am J Vet Res 1991, 52:1537-1541. PubMed Abstract
-
Huang H, Unver A, Perez MJ, Orellana NG, Rikihisa Y: Prevalence and molecular analysis of Anaplasma platyin dogs in Lara, Venezuela.
Braz J Microbiol 2005, 36:211-216. Publisher Full Text
-
Ferreira RF, Figueiredo Cerqueira AdM, Pereira AM, Guimaraes CM, Sa AG, Abreu FdS, Massard CL, Pereira Almosny NR: Anaplasma platy diagnosis in dogs: Comparison between morphological and molecular tests.
-
Hua P, Yuhai M, Shide T, Yang S, Bohai W, Xiangrui C: Canine ehrlichiosis caused simultaneously by Ehrlichia cani and Ehrlichia platy.
Microbiol Immunol 2000, 44:737-739. PubMed Abstract
-
Chang AC, Chang WL, Lin CT, Pan MJ, Lee SC: Canine infectious cyclic thrombocytopenia found in Taiwan.
J Vet Med Sci 1996, 58:473-476. PubMed Abstract | Publisher Full Text
-
Inokuma H, Fujii K, Matsumoto K, Okuda M, Nakagome K, Kosugi R, Hirakawa M, Onishi T: Demonstration of Anaplasm(Ehrlichi)platy inclusions in peripheral blood platelets of a dog in Japan.
Vet Parasitol 2002, 110:145-152. PubMed Abstract | Publisher Full Text
-
Brown GK, Canfield PJ, Dunstan RH, Roberts TK, Martin AR, Brown CS, Irving R: Detection of Anaplasma platy and Babesia canis vogel and their impact on platelet numbers in free-roaming dogs associated with remote Aboriginal communities in Australia.
Aust Vet J 2006, 84:321-325. PubMed Abstract | Publisher Full Text
-
Sanogo YO, Davoust B, Inokuma H, Camicas JL, Parola P, Brouqui P: First evidence of Anaplasma platyin Rhipicephalus sanguineu(Acari: Ixodida) collected from dogs in Africa.
Onderstepoort J Vet Res 2003, 70:205-212. PubMed Abstract
-
de la Fuente J, Torina A, Naranjo V, Nicosia S, Alongi A, La MF, Kocan KM: Molecular characterization of Anaplasma platystrains from dogs in Sicily.
Italy. BMC Vet Res 2006, 2:24. BioMed Central Full Text
-
Beaufils JP, Inokuma H, Martin-Granel J, Jumelle P, Barbault-Jumelle M, Brouqui P: Anaplasma platy(Ehrlichia platy) infection in a dog in France: description of the case, and characterization of the agent.
-
Cardoso L, Tuna J, Vieira L, Yisaschar-Mekuzas Y, Baneth G: Molecular detection of Anaplasma platyand Ehrlichia caniin dogs from the North of Portugal.
Vet J 2010, 183:232-233. PubMed Abstract | Publisher Full Text
-
Ulutas B, Bayramli G, Karagenc T: First case of Anaplasm (Ehrlichi)platyinfection in a dog in Turkey.
-
Otranto D, Testini G, Dantas-Torres F, Latrofa MS, Diniz PP, De CD, Lia RP, Mencke N, Stanneck D, Capelli G, et al.: Diagnosis of canine vector-borne diseases in young dogs: a longitudinal study.
J Clin Microbiol 2010, 48:3316-3324. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Pantchev N, Schaper R, Limousin S, Norden N, Weise M, Lorentzen L: Occurrence of Dirofilaria immiti and tick-borne infections caused by Anaplasma phagocytophilu, Borrelia burgdorfer sensu lato and Ehrlichia caniin domestic dogs in France: results of a countrywide serologic survey.
Parasitol Res 2009, 105(Suppl 1):S101-S114. PubMed Abstract | Publisher Full Text
-
Schouls LM, Van DPI, Rijpkema SG, Schot CS: Detection and identification of Ehrlichi, Borrelia burgdorfersensu lato, and Bartonellspecies in Dutch Ixodes ricinuticks.
J Clin Microbiol 1999, 37:2215-2222. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Solano-Gallego L, Baneth G: Babesiosis in dogs and cats-expanding parasitological and clinical spectra.
Vet Parasitol 2011, 181:48-60. PubMed Abstract | Publisher Full Text
-
Solano-Gallego L, Trotta M, Carli E, Carcy B, Caldin M, Furlanello T: Babesia canis cani and Babesia canis vogel clinicopathological findings and DNA detection by means of PCR-RFLP in blood from Italian dogs suspected of tick-borne disease.
Vet Parasitol 2008, 157:211-221. PubMed Abstract | Publisher Full Text
-
Matijatko V, Mrljak V, Kis I, Kucer N, Forsek J, Zivicnjak T, Romic Z, Simec Z, Ceron JJ: Evidence of an acute phase response in dogs naturally infected with Babesia cani.
Vet Parasitol 2007, 144:242-250. PubMed Abstract | Publisher Full Text
-
Beck R, Vojta L, Mrljak V, Marinculic A, Beck A, Zivicnjak T, Caccio SM: Diversity of Babesia and Theileria species in symptomatic and asymptomatic dogs in Croatia.
-
Vojta L, Mrljak V, Curkovic S, Zivicnjak T, Marinculic A, Beck R: Molecular epizootiology of canine hepatozoonosis in Croatia.
Int J Parasitol 2009, 39:1129-1136. PubMed Abstract | Publisher Full Text
-
Zivicnjak T, Martinkovic F, Marinculic A, Mrljak V, Kucer N, Matijatko V, Mihaljevic Z, Baric-Rafaj R: A seroepidemiologic survey of canine visceral leishmaniosis among apparently healthy dogs in Croatia.
Vet Parasitol 2005, 131:35-43. PubMed Abstract | Publisher Full Text
-
Ceron JJ, Eckersall PD, Martynez-Subiela S: Acute phase proteins in dogs and cats: current knowledge and future perspectives.
Vet Clin Pathol 2005, 34:85-99. PubMed Abstract | Publisher Full Text
-
Eckersall PD, Bell R: Acute phase proteins: Biomarkers of infection and inflammation in veterinary medicine.
Vet J 2010, 185:23-27. PubMed Abstract | Publisher Full Text
-
Rikihisa Y, Yamamoto S, Kwak I, Iqbal Z, Kociba G, Mott J, Chichanasiriwithaya W: C-reactive protein and alpha 1-acid glycoprotein levels in dogs infected with Ehrlichia cani.
J Clin Microbiol 1994, 32:912-917. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Martinez-Subiela S, Strauss-Ayali D, Ceron JJ, Baneth G: Acute phase protein response in experimental canine leishmaniasis.
Vet Parasitol 2011, 180:197-202. PubMed Abstract | Publisher Full Text
-
Pantchev N: C-reactive protein as a marker in canine granulocytic anaplasmosis.
Vet Rec 2010, 166:632. PubMed Abstract | Publisher Full Text
-
Jongejan F, Fourie JJ, Chester ST, Manavella C, Mallouk Y, Pollmeier MG, Baggott D: The prevention of transmission of Babesia canis canis by Dermacentor reticulatus ticks to dogs using a novel combination of fipronil, amitraz and (S)-methoprene.
Vet Parasitol 2011, 179:343-350. PubMed Abstract | Publisher Full Text
-
Wong SS, Teng JL, Poon RW, Choi GK, Chan KH, Yeung ML, Hui JJ, Yuen KY: Comparative evaluation of a point-of-care immunochromatographic test SNAP 4Dx with molecular detection tests for vector-borne canine pathogens in Hong Kong.
Vector Borne Zoonotic Dis 2011, 11:1269-1277. PubMed Abstract | Publisher Full Text
-
Gaunt S, Beall M, Stillman B, Lorentzen L, Diniz P, Chandrashekar R, Breitschwerdt E: Experimental infection and co-infection of dogs with Anaplasma platy and Ehrlichia cani: hematologic, serologic and molecular findings.
Parasit Vectors 2010, 3:33. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Santos AS, Alexandre N, Sousa R, Nuncio MS, Bacellar F, Dumler JS: Serological and molecular survey of Anaplasm species infection in dogs with suspected tickborne disease in Portugal.
Vet Rec 2009, 164:168-171. PubMed Abstract | Publisher Full Text
-
Steuber S, Kroker R: Antiprotozoika. In Pharmakotherapie bei Haus- und Nutztieren. Edited by Löscher W, Ungemach F-R, Kroker R. Stuttgart: Parey; 2006:410-433.
-
Green C, Calpin J: Antimicrobal Drug Formulary. In Infectious Diseases of Dog and Can. Fourthth edition. Edited by Green CE. St. Louis: Elsevier; 2012:1207-1320.
-
Kock N, Kelly P: Massive hepatic necrosis associated with accidental imidocarb dipropionate toxicosis in a dog.
J Comp Pathol 1991, 104:113-116. PubMed Abstract | Publisher Full Text
-
Mathe A, Voros K, Nemeth T, Biksi I, Hetyey C, Manczur F, Tekes L: Clinicopathological changes and effect of imidocarb therapy in dogs experimentally infected with Babesia cani.
Acta Vet Hung 2006, 54:19-33. PubMed Abstract | Publisher Full Text
-
Pinyoowong D, Jittapalapong S, Suksawat F, Stich RW, Thamchaipenet A: Molecular characterization of Thai Ehrlichia cani and Anaplasma platy strains detected in dogs.
Infect Genet Evol 2008, 8:433-438. PubMed Abstract | Publisher Full Text
-
Abd Rani PA, Irwin PJ, Coleman GT, Gatne M, Traub RJ: A survey of canine tick-borne diseases in India.
Parasit Vectors 2011, 4:141. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Dantas-Torres F: The brown dog tick, Rhipicephalus sanguineu (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control.
Vet Parasitol 2008, 152:173-185. PubMed Abstract | Publisher Full Text
-
Harrus S, Perlman-Avrahami A, Mumcuoglu KY, Morick D, Eyal O, Baneth G: Molecular detection of Ehrlichia canis, Anaplasma bovi, Anaplasma platy, Candidatus Midichloria mitochondriand Babesia canis vogel in ticks from Israel.
Clin Microbiol Infect 2011, 17:459-463. PubMed Abstract | Publisher Full Text
-
Dongus H, Zahler M, Gothe R: The brown dog tick, Rhipicephalus sanguineu (Ixodidae), in Germany: an epidemiologic study and control measures.
Berl Munch Tierarztl Wochenschr 1996, 109:245-248. PubMed Abstract




